CPlasFal_1514


Sequence

>CPlasFal_1514 (4 EST) Length=306 TGTATCATATTTAACAATTATTTTTTATCACATTAAAAATTAAATAATTATAGCTTAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAATTTCATTTACCCATAAGTGGGCTATTTTTCTCAGTTTTTGTTATGGTTAATTTAGACAAATTATTTT GAATTTCTTCTTTTATTTCCTCTTCATTTAAATTTAAGGGATCTTCAAGATCATTCTGGAAACCTGGAATACATCCATTT TTGCATTTGCACTTCCCGCCTAAATATGTAGGGATGTCCTTTAAAAAAAAAAANAAAAATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1514: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041161399977N974650593M3gmbPfHB3.1, G. Roman Reddy
5041171399978N974660593M7gmbPfHB3.1, G. Roman Reddy
5041351399996N974990606M3gmbPfHB3.1, G. Roman Reddy
5041361399997N975000606M7gmbPfHB3.1, G. Roman Reddy


Date: 15:2:27 on Fri 24 Nov 117.