CPlasFal_1529


Sequence

>CPlasFal_1529 (2 EST) Length=488 TATTTTTTTTTTTTTTTTTGTTATTCCACCGTTGTACAGTTATATACATACACATATGTATAATTTAAAAAGTAAATAAT ATATAATTATGTCATATAAAAATCTTTCAAAAATTAAAAGAGAAATCTAAGCTTTACATTTCCATACTTATTTATTTTTA TATATATTGAAACACTTTTAATAATACGAATTTATTATAATATAAATACTGGTTATGAAAAGCACAAGCAGCTAATGAAG AATTATTCTATAATTTTTTTTGTTTGCGCGCTCATATATATATATATATATATATATNNNANNNNNCNCACTCNNTNTCT TTNTGTNTGTCNATTTTNCTTNTNATTTTTNNTTTTTGTGCACACACNCNCANATATACACAANTTAAAAATTTATACAA TTCATTATGGTTTTTGAAAANGAGNCCAAGNCGTGCATGACGGNTGTTCGTNATGNTTTNCAAGCCCGTGAAACGGCNGC GGNAGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1529: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2863319200T026810042M7gmbPfHB3.1, G. Roman Reddy
5047011674885N978671415C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:28:6 on Mon 20 Nov 117.