CPlasFal_1538


Sequence

>CPlasFal_1538 (4 EST) Length=563 AACTAGGGNACTATATAACCNANTTCCCCTTTCCCCAAGTTTTACAANTTTNTCACTATTACANCTATAAAATGGTATAT ANTTTATATAAAAATTCATTAACAGGNAATAGGATTATATAGTTATATATATTTAACTTGGTATTATCTTTTATTTTATT TTTTTTTTTTTACAGATTTTGTGACGATATTTGGTACAGAATATTCATAACACTAATTTCGTTTAAGCCATAGTTTGGAA GTCTTCCATTGTTCACAAGGCATCAAGAAATGGAAAAAAAAAAAAAATAAATATATATATATAATAAAATAATAAGATAA AAGAAAAATATAATAATATATAATATAATAAATAAATAAAAAGTTTATTATATATATATATACATATATATATATATATA TATCACATATATTATATATTATTATACTATAGAGATTAATTTGATTTTTGAGAGTTTTATTTCTGTCATAAAAAAAAAAA AAAAAAAAAAGTAAAAATAATAATAATAATAATTANTATATATAATATAATATAATATGTATAGTTTTCCTCGTGCCGAA TTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_1538: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2860319197T026780041M3gmbPfHB3.1, G. Roman Reddy
44233462980T181940801c3czapPFDd2.1, Debopam Chakrabarti
5043531674537N981710115C3czapPFDd2.1, Debopam Chakrabarti
5045981674782N977641220C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:20:10 on Mon 20 Nov 117.