CPlasFal_1548


Sequence

>CPlasFal_1548 (2 EST) Length=361 TTTCCCCAAATAAGNGGTGAAGCCCCCAAANCGGAACAATTTNACNNGGGGAAAATTTTTCCCGGTTGGGGNTTTTTANT ATATANAAAACNTATTANATNAAAAANTTTTTANGGTAAAATTTATGNCGGGAAANCCTTTTTTTTTTTTTTTTTTTTTT TTTTTTTGGTTATGTTGATAATAATNACAGTCAACTATTGTAAGGCAAAATTTAAAAGTAACACAACAAATTTATAAAAT TTATCTACCACTGAAATTCGGCACGAGCAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAGATATGAAATATAAATAAAAN GTNTACATTATAAATATTATTATTATATAAANNTGGGAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1548: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2864319201T026820043M3gmbPfHB3.1, G. Roman Reddy
5043851674569N982030287C3czapPFDd2.1, Debopam Chakrabarti


Date: 6:25:31 on Thu 23 Nov 117.