CPlasFal_1599


Sequence

>CPlasFal_1599 (2 EST) Length=289 GAAAAGGAAAATTATGAAAACAATAAAACATATAATAAGGAAGAATCATATAATGTACTTGTTAGCATGCTAAAGAAGAT TTGTGATGAATATATTAATGTAATCATAAATAATATTGATATATTATCTTCTTATGTAAATAAGAAAAAGAAAAACATTA AAGAAAATAGGACCACATTTGATGATACGCTTCAATTTGTTTTACATCTCAAAAAAACATTGTGTAATATAAAAGATAAA ATAGAAAGTATAAACAAANATAACGTAAATCCAAATATAANTATAANNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1599: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041581400019N975220621M3gmbPfHB3.1, G. Roman Reddy
5041741400035N973260632M3gmbPfHB3.1, G. Roman Reddy


Date: 18:25:2 on Fri 17 Nov 117.