CPlasFal_1601


Sequence

>CPlasFal_1601 (3 EST) Length=516 CTCGAGTTTTTTTTTTTTTTTTTTGCATTTAAAATATTAAAAATTATTCAAAAATAAAAGTTAAAATCTATATGTTTATA TTTCTATATGGACATAAATTTGNATATATATATATATATATATATATATATATATATATATAGAATTTCTATTCATATAT GTTTATATAAAAAATATCCTATTATTTAAAGCATTTTCTTGAAAAAGTAAACACAAAAAATTATATATATATATTATAAA TATAACATTTGTAAAATTAAAAAAATTAAAAAAAAAAAAAAAAAAAAAGTGAAGTTTCTAAATGAATACATCAACATAAA ATTTTATTAACAAAAAAGGAGCTTACAATAAATGAAAAAAAAAAAAAAAANTANTATTTGAGGGCAAAAGATAACCAAAA GGAAATATATATTATTTTTTGTATGAATATAAGAAATGAATTTGAAAGAAGTATTTAAATGTTTNNCAGTATTTATATGA TATGTTTATGGATACAATTTCTTTTTTTCTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_1601: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28688319424T095920186m3gmbPfHB3.1, G. Roman Reddy
5048761675060N980262077C3czapPFDd2.1, Debopam Chakrabarti
5049431675127N980772232C3czapPFDd2.1, Debopam Chakrabarti


Date: 21:9:5 on Sun 19 Nov 117.