CPlasFal_1605


Sequence

>CPlasFal_1605 (2 EST) Length=309 ACCTCTTTTCATTAATAACCTTTGCACATACATTTGCCCCGTCAATTACAATAGATCTAAACTTAAAACCTTCCATCGGA AAAATATCAAAACCTTCATGAATTCTTATTAAATATGAATAACAATAATTATATAATCCTTGTTTTGTAGTATTATATCC ATAATTAAATTTAACGTGACATATAGGTTTTATATTATAAGTAGTTAATATAGGAGAAGATAATAAAGCTGTTATATTCA ATATGTCCTTTGGAATAGTTAAAGGTTTTTCTTGTTCATACAAATCATANATTATANTTTCATTAGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1605: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44196462943T181570740c3czapPFDd2.1, Debopam Chakrabarti
44270463017T182310865c3czapPFDd2.1, Debopam Chakrabarti


Date: 11:45:27 on Wed 22 Nov 117.