CPlasFal_1614


Sequence

>CPlasFal_1614 (2 EST) Length=287 TTTNCCCTAAAATACATAATCATACAAATAATTCTAATTAAATTAACAGCATACCAAAATAATGTGATATGCATTATAAT TATACGTGAGCCTTAATTTTTAATATGACAACTTATATTTCATATTACTATAAAAAAATTTAATACATTACCAGAAGGAT TAATAATAAAAGAAAAAAAAAGAAGAAAGACAAACAGACAGATAGACACCTTTCATACAAATTAAAAGAAAACAATTTAT AATTACAAAAATTATTAATTATAACTTCCTAATATACATATATATNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1614: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28601319337T095050068m3gmbPfHB3.1, G. Roman Reddy
28602319338T095060068m7gmbPfHB3.1, G. Roman Reddy


Date: 23:40:39 on Fri 17 Nov 117.