CPlasFal_1656


Sequence

>CPlasFal_1656 (2 EST) Length=383 GCAATGTTGAGCTATTATAGGATTGTTTCTGTATATATTTGTATTTATTTTGTACCTAATTCATTGAAGGAATCATAACA GAGAAATGAGAAAACGTTCCTATGTGTTTGATTTTTATTTTTTTTTAACAGTATATATTCCCATTTATATTTTATAATTG TTTTACACCACTGTAAATTTTTTATTTTTTTTTATTTAAAGAAATATACTGGTTATATGTTCATTCATACTTTGTTTTAG TTTTTAAATCATTTTAGACAGCTATTTTTTATATATTTTTTATTTATTTATTATTTTTTTTTTTTTTTTTTCCCCCTCTA TTTTCTTATGAATGCACTAATTTATAAAACGTGCGATAGATAAAAAAAACTTATTTTTTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1656: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049741675158N981082194C3czapPFDd2.1, Debopam Chakrabarti
12003432320585AA5503331474m3gmbPfHB3.1, G. Roman Reddy


Date: 2:33:46 on Thu 23 Nov 117.