CPlasFal_1657


Sequence

>CPlasFal_1657 (2 EST) Length=280 TTCATTTAATAAATATATTGGAGAGGTACACTTTTGGCATTGAAAAATATACATAGTAGAATAAACAATTAATTTTAAAG CTGTGAATGGTGTGTGTACTTACTACATAACGAATCAATCTTTCGCCTTTTACTAAAGATTGCCGTGTAGTAAGTATGTT AAATACAATATACCACGAATTTTTGTCGCGCCTATTAAGTTAGGTGCTCATCACAAAAACCCCCATTAACAATTATAAAT TATCAATTTTTTTTACATGAACAATTTTAAATAAATAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1657: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28871319607T097750364m3gmbPfHB3.1, G. Roman Reddy
28872319608T097760364m7gmbPfHB3.1, G. Roman Reddy


Date: 13:9:26 on Sun 19 Nov 117.