CPlasFal_1662


Sequence

>CPlasFal_1662 (2 EST) Length=384 TGTGTATATGTTTAAATTCTTTTGCTTTTATTTAAGGAAAAGAATGCACATTACANAATAGCAATGAATATTTAAATCTA TNNTTTGTATTGATACAAGCTTCTAATTTGTATTGCCTTTAGTTTGGTGGTACCCTATTTATGTGAAATGAAAAAATGAA CAACATATGAGTGAACAAAGTTAAAAATTTTTTTTTTTTAATTCGGAACAAAAATATATGAATATCTTATTTGAATAGAA ATAGAAATATATTAAATAAAGAAAATATACATTTCCTTAATTTTTTTTGTAAAATTGTGTATTCTAGGTTTTGCATGAAA CTTTTACTAGTAAAGGAAAAGTTAAATATTTGTAACCAGCATATGAAATCATATATTTATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_1662: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2955319289T027730111M3gmbPfHB3.1, G. Roman Reddy
2956319290T027740111M7gmbPfHB3.1, G. Roman Reddy


Date: 18:19:25 on Fri 17 Nov 117.