CPlasFal_1684


Sequence

>CPlasFal_1684 (2 EST) Length=278 GGTACGGTATTGAATATATATATGAAAAAAAGAAAAATCGAATGTTCTTTTTATTTGTTATAATTTTCTTTTCTTTATTT ATTTTGTATTACTTTTATCTGGGTTATATTAGAGGATATTTAAGTGTTAATGAATTTCACATATTACTTTTTATCCTATA TATATTTTGTATCGTAGTATATTTCAACAATATTTTTACTGAAAAATTACTCTTATTAAAAAATATTGGAATTCAAATTG ATAAAAAAGATTCATTTGAAAACTATACAAAATTTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1684: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44107462854T180680448c3cbsPfHB3.1, Debopam Chakrabarti
44120462867T180810469c3cbsPfHB3.1, Debopam Chakrabarti


Date: 4:21:54 on Thu 23 Nov 117.