CPlasFal_1687


Sequence

>CPlasFal_1687 (4 EST) Length=701 AGTATAACCCCATGATGCCATGAAACAGATGAAATTAACTTCCTTTTTAAGTAAAGGANNAATAAATTNAAATACGAATG TATTGNAAAGAAGAAGAGAGTACTAATAATATTGATAATATGAAGAATGTATACAATGTATGTNCCGAAAATAATATGAA TGATAATAATNCAGGGGANCATATTGTAAAAGNTGAATTAAATGATGAATCAAATTTAAAAGATCCTGCGGATAATATGG ATTATACTTTAGTAAAAATAAAAAAAAAAAAAAAAGAAAACTGTTGAGAGAAAAAAGAAGAAAAGCTAATGGNGGTACTC CTATTGAAAAATTACACCCAATTGTACACTGTCCAACTCAAAGATATAATTTTAGAACTAGGCTAGGAAAAGGATTTACC TTTGAAGAGTTAAAGGGAGCCGGATTAACTCCTAGAGCTGCACAAACTATAGGTATATGCTATGACAAAAGAAGAAAAAA CAGATCTGAAGAATCCTTGACAAAAAATGTCGAAAGATTATTAAAGTATAAGAACAGTTTAGTTATGATCCCACTTAAGA AAAACAAAGCAAAGAAAGGTATTGGAGGTATCCCAGCTGATGCTGATAAGAATACCATCCAAGAATTCAGAAATAAGAAA CCATTACTCAGTATTTACAAGTCCNCTAAGGACACTGGNCCANNCTATGAAGCTATGGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1687: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44023462770T179840298c3cbsPfHB3.1, Debopam Chakrabarti
44029462776T179900309c3cbsPfHB3.1, Debopam Chakrabarti
5049321675116N980662152C3czapPFDd2.1, Debopam Chakrabarti
5049801675164N981142205C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:24:12 on Sun 19 Nov 117.