CPlasFal_1711


Sequence

>CPlasFal_1711 (4 EST) Length=506 CATTCAAGAAAAATTGGCTAACAACATTGAGAAGTCATGTAATATTAGTCAATACGGTATAAAATCTAAAAATTTAAAAG ACATGATTGATATAAACTTAAGTATACACAAATGGAACCCAGCTGAAATCGAGAAATTAGCCTATTCCTTTGTTTTATCT TGTAAGATGCAAAAATTGATGTATAAACCAATGAACGTTGAGAAATTACCTTTAGAAGATTACTACAAATTATCCTTAGC CCCAGATATGGTAAAGACATATCACTGTTATAAATTAGGAAAGCAAGCAGCTAAATTATTAGAATCTATCATTTTAAAGA AAAAGTTCGTAAGATTTAGAGTTACTGATGCTATTGATGTATATGATTTCTTTTATATAAAGAAAGTTTTATCCAGTCGT ATTAAGAAAGAATATAATGAATTTTTACAAGACAAAAGAGCATTTGAAAAGAAAGAACTTGAAACAATTTTAAACAATAG TCCATTCTCAGANGAGCAAACAATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_1711: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44139462886T181000603c3czapPFDd2.1, Debopam Chakrabarti
44259463006T182200837c3czapPFDd2.1, Debopam Chakrabarti
5045841674768N977501194C3czapPFDd2.1, Debopam Chakrabarti
5045971674781N977631214C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:44:26 on Sat 25 Nov 117.