CPlasFal_172


Sequence

>CPlasFal_172 (3 EST) Length=791 ATTCATTTCTACTTTGGTTCCATCTTTTTCATATGTTCTTGATTTAGATGAATCATATAGATGTTTAGTTAAACATCCTG CAGTTGTACATTTAACACTTGGGACCCATAAATTAGCAGATCCTGTATCAAGAATAAATGTAAATGGTTGTTGGTTATCT CCAACTTCTGCATCACCATAAAACATTATATTTTGGAAATCTACTAATTCGATATTATCATTTGAACTACCTAAATAATT TGTTTTAGTAAGTCCTGAATTAAGAAAATTGACAGATTCTTTAATGTAATTTTTTAATTTATGTGTTTTTATAGTTTTCA AAATCCTACCATGTGCATTTCCAACTTTAAATCCAATAGTTAAATGTTCGGAATTTTTTAAAATTTCATTCATTTCATTA TCTCTTTGAAGCCATACATTTTCATACACATAATAAAATAAACCACACATTACACTACAAAAGAGAAGTACATATAGTAT TTGAAACCCTTCCTGTATTTTTTTTTTGTTCTTTGAATTGTCAATGTTTAATCCATCAAATGTTGAATTGCTTTTGATAA AGCCATGTTTAAAATCATGTTCTCTTACTGTAATATCCATTTGGTTCAAAATATTTATTAAAAATTTAAAAAAAAATTAT ATATATAAAAATAAATAAACTTTTTATATTAATTTATAAAAAAATTATATTTCTTTTTTATATTTTATATTAAAATTTAC ATACCAAATTCTTCTTTTCCATTCTACATATTTCCGTTAAATACTTTTTATACTGAAAATTTTATATTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_172: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2909319245T027270075M7gmbPfHB3.1, G. Roman Reddy
5044661674650N976321078C3czapPFDd2.1, Debopam Chakrabarti
11998922320134AA5498820955m3gmbPfHB3.1, G. Roman Reddy


Date: 0:42:16 on Fri 24 Nov 117.