CPlasFal_1726


Sequence

>CPlasFal_1726 (3 EST) Length=466 CTTTTATGNATTAATTCTTATAAATATATTTTTTTTAAGTTTAATGTTAAACCAAAAGTAGTTATAAAAATATAGTAATT TCGAATATAATGTGATCCAAGTTGGAAAAGNAAAAAAAAAAAAAAAAAATATATATATATATACCAGAAANTATATATAT ATATATATATATATATATATATATATATTTACATATATAATGGTAATATTCTATTTAAGTTTAGNAAATTAGAAAAAAAA AAAAAAAAAAACGTTTTCATTAAAACTAGAGAAAAAAATTGTATCTACATATAATAATGTATTATTTATTGTTGTTCTTA TTATATATGACATATATTAAATATAAAATATTAAATTAGTTCATTTGTCAAAAAAGTTAAAATTCATACAAAAATATTTT TGGCTATAATAATCTAAAACAAAAAAGTATTTTTTGCCCTTACACAATTAGGATATTATATAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_1726: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28978319714T098820443m7gmbPfHB3.1, G. Roman Reddy
5048501675034N980002020C3czapPFDd2.1, Debopam Chakrabarti
5049011675085N980512115C3czapPFDd2.1, Debopam Chakrabarti


Date: 3:56:47 on Sat 18 Nov 117.