CPlasFal_1808


Sequence

>CPlasFal_1808 (4 EST) Length=483 ATTTAATCAACCTCTAACTCTATTAATTTCTTTTACAATTAATAATATATATAAAACAAAAAAGAAAAAAAAAGCAAAAT GGCAGTAGGAAAAAATAAAAGAACATCTAAGGGAAAAAAAGGTGGAAAAAAAAAAGTTACTGATGTTTTTACCAAAAAAG AATGGTATGACTTAAAGGCCCCAAAAATGTTTTTGGTCAGGAATTTTGGTAAAACCTTAGTCACAAAAACGATAGGAAAA AGTAAGTGAATAAATAAAAATAANCATATATATATNTTANCATACATATATATTANCATACAATATAACTAATATTTACA TATATATTAAACAAACTAACCTTTATAAGGNCAAGAAGCACAACGGAATGCATCACCCAAACTAACACTAAAAATATTAA ATAAATAAATATATATATATATNTNGGGGGTAATTATAANGTGGNNTACACAGNTAAAATAACAGTTCTTTTTTTNNNTT TTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1808: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2749271422T025680203C3cbsPfHB3.1, Debopam Chakrabarti
5041341399995N974980605M3gmbPfHB3.1, G. Roman Reddy
5041401400001N975040609M3gmbPfHB3.1, G. Roman Reddy
12001172320359AA5501071206m3gmbPfHB3.1, G. Roman Reddy


Date: 20:7:34 on Sat 18 Nov 117.