CPlasFal_1820


Sequence

>CPlasFal_1820 (2 EST) Length=317 CACGAGGAAGGACTTAAAATGAAATTAGGTTTCTTTATTAAAAAACATTCAAATGTTTTCAAATTTGATACTGAAGGACA AATTGTATCATTAAAATAAATATAGTGGACATTATGAAAGTAAATATGTATTATATATATATATATATATATATATATAT ATGTATACATATTAAATTATATATATTTTTTTGATTTATATGATTTTCATTGTTTTATGTTTATTTCGCGTGAAAAGAAT TATGTTTTTAAAAGGGGCTTATTGNACTNCCATACAACATTAAGTATTAATTATATTCATATTTATAAAGCACAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1820: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043521674536N981700110C3czapPFDd2.1, Debopam Chakrabarti
5047191674903N978851450C3czapPFDd2.1, Debopam Chakrabarti


Date: 5:58:18 on Sun 19 Nov 117.