CPlasFal_1823


Sequence

>CPlasFal_1823 (2 EST) Length=257 GGAAGTAGTGGAAAGAGAAAAAGAAAAAAGAAAAATCGAAAAAATTATATTTTAATCTTTTACATTAATATGATGTCATT CTATAAAATGTAATAAGAATATTAAGATCTATGAAATGTAAGTATTTTTTTTATTTTATTTTCCGAAATTTTCTTTTAAT TTATAACTTGTATATGGTGTTAACATATTTTATATAAATCATTCTAAGGGTAAAATTTCTTATTTTTTGATTGACTAACA TAAATAATATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_1823: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041321399993N974960604M3gmbPfHB3.1, G. Roman Reddy
5041331399994N974970604M7gmbPfHB3.1, G. Roman Reddy


Date: 2:49:8 on Fri 24 Nov 117.