CPlasFal_1838


Sequence

>CPlasFal_1838 (2 EST) Length=254 TACAATTTATAATATACATAATAATGCTTTAATATGGCACATTTATATGAAGAGGTTTATAAAAAGAGAAAATATTTTAA TAGAGCTTTATGTAATGATTATGAAGAATGGCAAGATAAAATAAGAGAATCAAAAACGGTTTATATAGGAAATTTATCCA TATATACAACACAACAACAAATATATGAGGTAAGCAAAAAGGAAAATATGATATAATCATAGGTTGTAATATATATATAT ATATATAGCGCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1838: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2934319270T027520093M3gmbPfHB3.1, G. Roman Reddy
2935319271T027530093M7gmbPfHB3.1, G. Roman Reddy


Date: 16:29:17 on Sat 18 Nov 117.