CPlasFal_1849


Sequence

>CPlasFal_1849 (2 EST) Length=252 GGGGATGAAGAAGCAAAATTAATGTTTCAAAAAATAAATGAAGCATATCAAGTATTAAGTGACGAAGAGAGAAGAGAACA ATATGATAATTACGGGAAAAATGCAACACAAAATATGTTTCTTATAGATGGATCTTTTTTTTTCACTTTAGTATTTAGTT CAGAGAAATTATGTGATTATATAGGAACATTACAGATATCTACCTTTGTTAAATTAGTGCATGAAAGAGGTATGAATTCA AATGATTTATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1849: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28796319532T097000291m3gmbPfHB3.1, G. Roman Reddy
28797319533T097010291m7gmbPfHB3.1, G. Roman Reddy


Date: 16:15:4 on Sat 18 Nov 117.