CPlasFal_1905


Sequence

>CPlasFal_1905 (2 EST) Length=321 ATATATATATATTGTGAAAATATAAAAATAACTTCACAACCGTCATGACACACTACAACAAAAATGTATTATGTCCNCGT GAACTGTCATATTAAAATATCAATTTAAAAAATAGTATATTAAATATATTTTATTATTTATTTATTTATTTATTTATTTA TAATNTTTTTTTGTTGTCTATCATTATAGTGTTCGTTTGAAAAAAGATATATTTGTTAACATTTTATGCAACGTTTTAAA AATTTGTCTTTTTTTTTTTTTAACATTTAATGNAGGATATAAAATATAANCAGTGCTACTAATTTTNTTTATCATTTTAA T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1905: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2757271430T025760213C3cbsPfHB3.1, Debopam Chakrabarti
29069319805T099730532m7gmbPfHB3.1, G. Roman Reddy


Date: 8:20:11 on Thu 23 Nov 117.