CPlasFal_1910


Sequence

>CPlasFal_1910 (2 EST) Length=244 TATATGTGCTTGTCGTGGATTTTTTTTTTTGTTTTTTTAACTTTCTTTATATTACCATTGATGATTTTCCAAAAACCCCA TTGTCCTTATTAAAAAAAAAATTTTTATTACCTTCTGCTAAACATCGTTTATATCTTATCACTATCTTTTCATTATATAT TCCTGTATCCTTACATACAAAGTTTTCCTGTCATTTATAAATTAAACAAATAAATAAATGTAAACATATATATATAAATA TACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1910: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28605319341T095090102m3gmbPfHB3.1, G. Roman Reddy
28606319342T095100102m7gmbPfHB3.1, G. Roman Reddy


Date: 16:8:58 on Fri 17 Nov 117.