CPlasFal_1916


Sequence

>CPlasFal_1916 (2 EST) Length=355 ATTTTAATAGATTAAATATTTAAATGGTAAATATTGAATTTTCATTTTTTATTGTGTTGAACACATGAAATAAAAAACAA ATATATAATAAAAAAAAAATTTTGTCACGAAAAAACGAAGTTACATTTATTATAAATTTGTTCTTTTGAAAAGNTACATA TATATATATATAATATATATATATATTATATGTATATATATTATATATATATATATATATATTATATATATATTATAGTT TATATGTACATATTTATATTACATTAAATCATTTAAAAATCTTCACATAATTTTATTTCATTACATTCAAAAACTATATC TTATTAATACTAGTAAGGAAGTGAAAAAGAAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_1916: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046941674878N978601402C3czapPFDd2.1, Debopam Chakrabarti
5049301675114N980642150C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:40:30 on Thu 23 Nov 117.