CPlasFal_1928


Sequence

>CPlasFal_1928 (2 EST) Length=405 AATATATATNGCTNATTTATGGATTTATATCTTTTTAGGTTTANAATTATNATATGCACTTAATATATAACCACAACGAA TAAGGCAATATATTTTTATTAAACAGTTATGTGTCTTCCCTTTGTATTATTTTGTCTTCTCAGTAAAAAANAAAATATGA TGNAAATTGTTTTAATATAATAATATATAATATGCAATAATATATATATATATATATATATATGTATGTATTGTAAGTGT GAATGCGTTTTTATATGCCTAACTATGGACCAAAATATGTAATATATATATTTTTTTTTTTTAGGAATTATCCAAACATT TTGACGTGAAAAAGGTTTTGGAAAGATGCTAAAAAATATGAAAGTAACTAAGTTGTTATTGATAACAAATATTTAATTCA AATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1928: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28865319601T097690360m7gmbPfHB3.1, G. Roman Reddy
28963319699T098670435m3gmbPfHB3.1, G. Roman Reddy


Date: 1:35:30 on Sat 18 Nov 117.