CPlasFal_1948


Sequence

>CPlasFal_1948 (2 EST) Length=229 TAATTATTTATGTATTTTATTTTTCAATAATTAAAATTTCCATTAATTATTCTATATATGAAAACAATAAAATAAATTAT TTTTTTATTATATAATCAAAGTAATATATAATAAAATTATATGCAAGCATATTTCCTAATAGAAAAAAAAAAAAAAAAAG GAAAAAATATATAATATATAAATTAATATTTTTAAAGCAACATATATTATTATATAAACCTTTTTAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_1948: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048561675040N980062029C3czapPFDd2.1, Debopam Chakrabarti
5049681675152N981022181C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:18:33 on Fri 17 Nov 117.