CPlasFal_196


Sequence

>CPlasFal_196 (2 EST) Length=743 CATATTGTTTTTTGAATTAAAAATGAAAATGCATTACCTTAAAATGTTATTGTTTACGTTTTTAATAAATATTTTAGGAT CACCCCATAATGTATGTAAAAAAAAATACACTAACTCATATTACAATAACATAAATATATATAACAAAAGAATTATTACA TTTTCAGTAGTATATTCATTAATCCTCTTTATTATTTTTTAGGAAAATTATCATAAATAACCATTATAATATAAACGTCA TTGTACAAAACAACACCACAAAGAACAACGATAAATTCAAGATTATTAGCACAAACGAAAAACCAGAATCCACATTATCA TAATGATCCAGAACTCAAAGAAATAATTGATAAAATGAACGAGGAAGCAATAAAAAAATACCAAAAAACTGCATGATCCA TATAAACAATTGAAAGGAACTAGTAGAAAAAAAAGGAACGAACAATATACAGGTGGTACATCATGCAGAACCGATATCAA CGCTAGAAAAAGAATTATTGGAAACATATGAAGAAACGTTTGGTAACAAAAAACATATTATGTTAAAATCGGGTATGTAA CACCAAATCAATACGACAAATCAATTGACGAATCCTCAACATGTGAATGTACTGATAATAATAAAGCGAAACTAGCAAAC AACAAAAGGAAGAGATAAATATTTAAAACATTTAAAACATAGATGTATAGGTGGAATATGTTCTTGCTCAGTAGGTAGTT TTCTCTTAACAATGATTGGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_196: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999262320168AA5499160989m3gmbPfHB3.1, G. Roman Reddy
12002812320523AA5502711398m3gmbPfHB3.1, G. Roman Reddy


Date: 11:17:16 on Sun 19 Nov 117.