CPlasFal_1961


Sequence

>CPlasFal_1961 (2 EST) Length=225 TATTCATTTTATTTTTAATATTTTGAAAAAAAAATGTAAAGACGAATATATTTTTTTTTTTTTTTTTTTTTTTTGTAAAA ATAATGTGTTGTGAGGATCAATTATAACCTCACCACCAGTGTTACAATTTGAATATATAAAAAGCATATGTTTTTTTTTG TAAATTTTTTTTTCCTTTATATGTATTTATATGTAATAATCAAGCTTATCGATACCGTCNNCCTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_1961: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28599319335T095030063m3gmbPfHB3.1, G. Roman Reddy
28600319336T095040063m7gmbPfHB3.1, G. Roman Reddy


Date: 10:0:32 on Wed 22 Nov 117.