CPlasFal_197


Sequence

>CPlasFal_197 (3 EST) Length=886 TATATAAATTGTTGTATATAAGAAATGAATTTATTAAAGAGGACATTTTTATCTATACTAATTCGTATATTTCTCTTTCT TTTATTTTGTTTCTGTCGTCTTTTCTTTATTTTTATTTCTATTTTTTTCTCATTAATGGGATCATTATATTTGTTCATAT AAACATATTTTTCCAATAAAAATTTGAAAGCATGGATATGTCGATTCATTATAATATAATTTTTTATTTTATGGACATAT TGTTTTTGTATTCTTTTTTTTAAGAGAATTTCTTTTTCTTCTTCTACTACCAACTTTTTCTTTTCACATTTTTGTTGCTT TTCTTCTTTATATTTTATTTTCCATTTTTCATGTTTAATACTATGAGTCAGTAGATAGTAATAGCATTTTATTATTATAT ATAAATTGTACAAGTTTCTCTTTTCATAATAATAATTTCCCTCATTTGAATAAATGAATACACGATCTTCCTCATTTTTC TTTTTATTCTTATGCCTTCTTAGTCTACTCCTTATATTTACAAATTCATGTATTATTTCTTGTATTTTTTCCATCCTTTC AAAACTATACCCAAACGAAATAAATATATATAAATATAAATATATATATATATATATATTTAATGTGATGATAAGATTGT GATAATTATTAAAAGAAAAAAGAAGATTTATATTAGTTCCTTTTTCCCTTTTTATTTAAATGTTTTATATATAGCAGTGT ATTTATAATTTATAAATTGGACTTTATAAAAATGGTACACGCAATTTTTTATTTTTTTATAGCTAAAACCTTCAATTTTA TAAAAATCAGCCTCTTTTATTTTCTTCCTCTTTTTATATGGTACATAAAAAAAAATATATATAATTTATGACAATTAAAA ATAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_197: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44033462780T179940313c3cbsPfHB3.1, Debopam Chakrabarti
5046011674785N977671231C3czapPFDd2.1, Debopam Chakrabarti
12006372320879AA5506271815m3gmbPfHB3.1, G. Roman Reddy


Date: 6:11:13 on Sun 19 Nov 117.