CPlasFal_2014


Sequence

>CPlasFal_2014 (2 EST) Length=369 GGCACGAGGTTTTAATATAATAAGAGATACAATGAAATTATGAATTATATACATATGTATTATATTTATTCATTATACTT TTTATATGTTTTATTTTTATACATATATATATTTCATGAAGTTTTTTTAAATATTAATTCGATATCATTATTAACTATAA TATAAAACGTATGAGAAAAAATTATGGTTATATATATATATATATATATATCATACTTATAAGCATAAATTATTATGCGT AAAAAAAAGTTAATTATTATTATACACCTTATTATATTACTTAATATTNAATTGTTTCTAAAANTTTATAATATGATATA TTATATCTAANCGTGCACAACTGTACATTTGTCAAGGGCAATTGAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_2014: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44240462987T182010811c3czapPFDd2.1, Debopam Chakrabarti
44242462989T182030813c3czapPFDd2.1, Debopam Chakrabarti


Date: 17:10:54 on Wed 22 Nov 117.