CPlasFal_2042


Sequence

>CPlasFal_2042 (2 EST) Length=202 TTTTAAAATTTTAATTACCTATTTTTTTTTTTAATTTTTTATGTTTTTCTTTTTTTTTTCTTTTTTAAATCACTTGAATC TGATTTTCCTGCATTTCCATTTTGATTTTAATTTCCTTCAGATATTTGACCGTNAATGTTTGTATTGATTGTAGAAGTAG TTAAGTAATTTTTTNCAATTTAATTATNATTGTAANNTNCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_2042: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041651400026N975290627M7gmbPfHB3.1, G. Roman Reddy
5041671400028N975310628M7gmbPfHB3.1, G. Roman Reddy


Date: 19:46:53 on Mon 20 Nov 117.