CPlasFal_206


Sequence

>CPlasFal_206 (2 EST) Length=809 TGTATATGCCTTAATATATTTTTCATAACTTTTCCAATTGTAGATACCAAGTAGCTAATGATTTCGATATTAAAAGTTTA GCATCTGATGATGTCTTGAAATCCAAAAATAAAAAGAAGGAAGTAAAAAAATTGGGAAAAATATTTAGAGACAAGTAAGT TTAATATATATATATATATAAATACATGTTATATAACTTTCTTATTTCTTTCATTTTTTTTTTTTTGTTTTTTCCCTTTT TTTAGATTTTTGGAACCAGTTAACAAAAAAACCGGAGAGGTTTCCAAGGATATTTCCTTCTTACACAAAAAGTTGTACTT TTAAATTTTCTTACATTATTCAAATTACATAATGATTTTTTCTCGTTTAATAAATAATATTTTTCCCTTTTTTTTTTTTT TTTTTTTTTTTTTTTCTCTATTTTTTGAGACAAAAAGAAAAAATATTTTAAAATTAAAATTTATAAAGGGAAGAAGAAAA TAATNTTCCAAAGAAAAAAAACTTAAGCAGGCTTATAGTTGAAGAAGCAACAAATGATGATAATTCTGTTGTTGCATTAA ATACGAAAAGAATGGAAGAGTTAAATTTTTTTAGAGGTGACACTATAATAATTAAAGGAAAGAAACGACACTCTACCATT TGTATTATATTGAATGACAATGATTTAGATGAAGGAAAATAAGANTAAATAAGGTTGCAAGAAAAANCTTGAGAGTTTGT TTAGGAGATGTTGTTTATGTAAAGTCATGCCCAGAAATTCCTTACGGCAAAAAAATTCAGGTGTTACCCATAGATGATNC TATCGGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_206: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44283463030T182440902c3czapPFDd2.1, Debopam Chakrabarti
12003802320622AA5503701516m3gmbPfHB3.1, G. Roman Reddy


Date: 21:9:17 on Sun 19 Nov 117.