CPlasFal_2072


Sequence

>CPlasFal_2072 (2 EST) Length=310 CCCTCTTATCGGTTTTGTACAATTATCCACATTGTAAAATTAACCCTTTAATAATAAAATCAGTGAGTTGGTTAAAATAG CTTTTTTTTTTATAAAATTAGCTATTTTATAAATTCAGCTATTTAATAGAATTAGCCATTTTATATATTTTTTTTTTTTT ATTTTTTTTTTTTTTTTTCCGAACTGAATGTGGATAACATCAATTCATACAGAGTCATTTAAACTACTCAAGTTGGTAAT CAAACATTTTGTAATTCTACAAGCCCACATTTATTTTATTACACAAATAAAATATATATATATATATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_2072: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042221400083N973740418M7gmbPfHB3.1, G. Roman Reddy
12003912320633AA5503811527m3gmbPfHB3.1, G. Roman Reddy


Date: 13:39:50 on Thu 23 Nov 117.