CPlasFal_2074


Sequence

>CPlasFal_2074 (2 EST) Length=186 TATATATTGCATTTTTATAAAAGAAAAAAAAAATTACATAATTTTAATTTGTTTCTCTTTTCATTCATTAAATTATTATG TTTTATATAAATCTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGGTAGNGGAATTTATTTGGAAAAAAAAAAAAAAAAAA NAAAATNGGAAANTGGGATATANTNG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_2074: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2891319228T027090064M3gmbPfHB3.1, G. Roman Reddy
5045111674695N976770887C3czapPFDd2.1, Debopam Chakrabarti


Date: 12:13:47 on Mon 20 Nov 117.