CPlasFal_2135


Sequence

>CPlasFal_2135 (2 EST) Length=276 AAATATATATAAGGAGAAAGCGCTGTTTTTATATACATATAATGTTATGTATAAGCTTGTGGNAAAAAAATATATGTATA TATATATATATATATATATATATATGTGTATATAATTTTTAAAAATTATATTATTGTCTTTCAAAAAAAAAAAAAAAAAA AAAAAACATATTAAGCGAAATANTTTCCAAAAAAAAAAAAAAAAAAAGAATTTTGAATTAAATTATTTTAATTTATTATT AAAAAAAAACTGTTCATATTAGTTTCTTTTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_2135: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042171400078N973690386M7gmbPfHB3.1, G. Roman Reddy
5047561674940N979221542C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:38:28 on Sat 25 Nov 117.