CPlasFal_217


Sequence

>CPlasFal_217 (3 EST) Length=630 ATTTAATAACCACATAAGTATAAACAAAAAAAAAAATTTATATAGATGTTATAAAAATTGAATTATAATAATATTCATGT ATTCAAACATCTAGAGTTCATANAACATAAAAATGGATTTAATATCTTGAAACTATATATTTTTTGATTTAATAATTTTG TGTAATGGGCTTTTTTATTCATTTTTTTTTTTCTACGATAACGTAAAACTAAATAAATAATTATCATAACTAAAGCTATA ATTAATAATGCAACAACAGAAGCAATAATAGCAATCTGGAAACTAGCATATGTAGATTCTATTGTNGCAGTGCTNGTTTT TATAACTCCTTCAGTAGCCTTTTCTAAAGCTNTTTGCAGCAACATTTTNCGGCANTTTGAGACGGATAGNTTTTTACNAG GTACTTCTATAGAATTGTACTTTGAAGAAAACTTCCCTGGAATTTTCGGTGCAGCTAGAGATTTTTCCAACACCCAAGGG CATATAGAATTATCAGTGGCAGGGCCAGAGCCACCTATCAGACATGACGATGCGTTATATTCACTATTTATAGCAAGAGC AAGCTTTGTGACATTATTATAATTTTGTGCAGTAAATAAGGATTGTAATCCCTGAACACCTAGAGTTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_217: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2951319285T027690106M3gmbPfHB3.1, G. Roman Reddy
28771319507T096750260m3gmbPfHB3.1, G. Roman Reddy
12003112320553AA5503011430m3gmbPfHB3.1, G. Roman Reddy


Date: 11:51:7 on Wed 22 Nov 117.