CPlasFal_2178


Sequence

>CPlasFal_2178 (2 EST) Length=146 TATTACAAATCATAAATAATGTATATATTAATTTTTTTTTTTTTTTTTTTTTTTTGAAAAAAGATTAAGTTATATATACA TGATACTTTCTATAACTGGACGGTATTCTTAATAATTTAATACCTCAAACTTATCTGTATCATTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_2178: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041801400041N973320034M3gmbPfHB3.1, G. Roman Reddy
5041811400042N973330034M7gmbPfHB3.1, G. Roman Reddy


Date: 8:30:44 on Fri 24 Nov 117.