CPlasFal_246


Sequence

>CPlasFal_246 (2 EST) Length=1052 TTACAAATATATGCACATGCTCTCATCCATAGATCAACTAATGTTTTCAATAATGAACAAATAAAAAATGATTTATTAAA TATTGAAAATATATATCAAACACCTCGGGAAATACAAATAATTATTATTTAAATGGAATGTTAATGTTAATAACAACAAT TTTGATTTTAATTTAAATGTAAATGACTATTCAAATTTTGTTACGGATAAATTACCGCCTTATAGTAATTCATCTGACCT GTTCATAAATAATAACATGAATTTTCTGAACGACGCTAGTACTAGCCATGTTAATTTTCCGCTAGCTAATTCTCAAGTTG TTCAGGTAAATAATAATTATATTGGCAATATGGAAGCAAGTGTAAAACATAACATAAGTGTGGAGAATACATTAAATGAA ATAAAAGCGCCTGAAGTGGAATTACCATCAAATCAAAGGGCTCGTAGAAAAACAGCTGAAAAATGTTTAAAATTAATAGA GCAAGATAGATTAAGCAGGATGCAAAGTGAAAGCAATGCTCAATAATGTAATATGTACATGTATATATGTACGTCTCAAA ATATTGTATTTACTGAATATATATATATACATATATGTATTTTATTTTATTTGTATTTTATTTCCTCTTCCTTTTTATTA ACATATTTATAGCCGTACGATTCTTTGAGAATATAAAAAACGAAATGATAAATATGTCATCTAAAATTAATAAACAGCTA GATAGTCAAGATATAAGTTCCTTGAATAATTTTAAGAGAGCATCTGAAGTACTAAAAGAAAGTCTAGCAACAATGCATTC ATTGGATATTATTAGAAATGATGGCAGTGTAGATTTCTCAAGTAATTATAAAATTTTTAAAAAATTAGAAAAATAATAAA GATATTAATAAACACGTCTATGTCAACAATATTATATATAATATGTATTTAATTATACTTATACATTATTTATTATTATG GTTATACTCATATTTGTATGTTTTATTATTATAGAATATACATTGGACTGGTATTCCAAAGCTAACATGAGAGAAAAATA TTCTATCGAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_246: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000652320307AA5500551145m3gmbPfHB3.1, G. Roman Reddy
12001272320369AA5501171216m3gmbPfHB3.1, G. Roman Reddy


Date: 6:45:50 on Sat 25 Nov 117.