CPlasFal_263


Sequence

>CPlasFal_263 (6 EST) Length=855 TTTATATATCCTCACCTATACACTATGATATTATCATTAATTTGCATGTGTAATGTATATTTCTAGCGTTAATTCTGAGC TAGGATCAAACTCGCAATATAATAAAATATATATTTTAAATATATAAATAACATATATAGAAATTATATGGAAATAAGTA GAATTGAACTACTATCTTTATTATGCAAAAATAAGATTTTACCATTAAACTATATTCCCAAATATATATTTATATATAAA TATAAATATTCTTAATAGCTTAGTGGTTAAAGCATTCGGCTGTTAACCGAAATACACTAGTTCAATTCTAGTTTAAGAAG TTTAAATAAATATGAATAAAGAGATTTGAACTCTTATTATAATAACTAAAATCTAAATTTAGTGCGTTTACCTATTTCGC CATATTCATATATATATAAATCTAGTAAGATTTGAACTTACATATAAAACTTAGAAGGTTTTTATTTTATCCATTAAATT ATAGATTTTTAAGTAATATTGGATTCGAACCAATGGTCTTCTGTATGTAAAGCAGAAACTTTACCTCTAAGTTAATTACT TTAAATTTTATATTTATAAATAAACTTGTAATTTAATGGATAAAATATATAAATACGAATTATAAAATAAAAGTTCAATT CTTTTCAAGTTTATTTTTAGCGAAATAGAGCATAAGGAAAGTTCGTCGGATTCATGCTCCGAAGGTAATCGGTTCAATTC CGTTTTTCGCTTATAATTATATAAATTTATTTATTATAATTTAAATTAAATATATAATTAAATATATATAATAAATTTAA AAGGATGTCTATAATTTTTATTAAATAAGAAAGACGTTATATATATTAACGAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_263: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999342320176AA5499240998m3gmbPfHB3.1, G. Roman Reddy
11999432320185AA5499331010m3gmbPfHB3.1, G. Roman Reddy
12000052320247AA5499951074m3gmbPfHB3.1, G. Roman Reddy
12005702320812AA5505601723m3gmbPfHB3.1, G. Roman Reddy
12006332320875AA5506231806m3gmbPfHB3.1, G. Roman Reddy
12006342320876AA5506241809m3gmbPfHB3.1, G. Roman Reddy


Date: 11:32:44 on Fri 24 Nov 117.