CPlasFal_280


Sequence

>CPlasFal_280 (2 EST) Length=901 TTTATATTTTGTGAAGACCTTCCTTTTTTGAAATATATACCGAAAAAAAAAAAAATTTTAATTTAAAAAAGAAAACACAC ATACTTTAAAATGTTATTGCAGTATTCTTTTCCAAACTCTCTGAACGTTTTAAATACTTCTGATTAGAAACACCCGGACG GCTGTAATCTATATTGAAGGTACCCGTCAAGGGTGATGTTTCGTCAAAGGACAAATCAAAAATTGTAGTGGGCATAGTTG TTGATATTTCAGTCATTCGATTTTCTTCATCCACGTTATATTCATTAAAAAACATATTACTATTTGTATCAGGGATATAT TTATTACGATTTTTTCTTGTGGATATTTCGCTAACGGTTGTGTCAGAGTCATGATTAAAGGTTGTGTTTTCTTTATTAGA ATATAATATGATTAATAGTACTTGTAAGAGACTTAAAATAAAACCACATAAATTAGGTATTATAATAAATCCATCCTTTA ACGTAAAACCATATGTTAACCATAAAAAGGAACATAACAAACTACCCATCGTTACTTCCATAGGTATTAAAGATGAGTTT TTCTTCTTTATTACTATTTGGATATAAGATAAGGGAGCACCGAAGTTAACTATACTCGATATGAAGGCAACAAATCCAAC AAATACTTCATATTGTTCATATGATAATATATATAAAAATGCATATAATAAAAAACATATAAATCCACATATCTTATAAT AAGAATGTAACTTTTGCTTTAGCCACATGTTTTTACAATTCTTGTGATATATTACACAATATAATATTCCTAATATCAAT CCAACTAAATTGGGAAACACAATCGCTGAATTATTTAATAACATTCCATAAACTAACCATAAAAATGAAGATAATAATAA TATTATATATGGAAAACCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_280: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046471674831N978131308C3czapPFDd2.1, Debopam Chakrabarti
12004162320658AA5504061556m3gmbPfHB3.1, G. Roman Reddy


Date: 19:33:3 on Sun 19 Nov 117.