CPlasFal_289


Sequence

>CPlasFal_289 (3 EST) Length=1048 TAATAATGATAAAAAATATATTATCTGTGTACCTTTTTTCATTATAGAATAGTGATATAAAATGGAAGAAACATATAAAT TGTTGTAAATATCATTTTTACTTTTTTTCAAGTAAGAGATGCTTATTACAACATATGGTTGAAGAACCGTTTGAGAAAAA AGACAAATCTGGTGTTTTATTAAAAGAAAAAAATACTGAAGAGGGAAGAAAAAAAGAAAGACAAAAGCCTATGAGTATTA AATCAATAAATAAAAAAAAAAAAAAAAAACAACAACAACAATAATAATAATAATGTGTTAAAAAATTTAAATAATGAAGA AATAAATAAACAACGAAATATGACGAATGAAAGAATACGAAATAAAAATAAAAATGATAAAGGAGTTGAGAATATTTCAA GTAATACACAGATGGAAGAAAAAAATATAATATGTAAAGATATAAATTCGAATGTAATATTAAATCAAAACGAAATAAAT GACGATCAAATGGTTCAAAAAATAAAAGAAAATTTTGTCAAGGATTTAATGAAAAATGAAAACAAAGAAATATTTAAACA GATAGAAACAATTAATTCAGTTGGTACTATGGCAAAAATTAAAAATTCATTATATAGCATAATATTTAAAGGGTCTAATT TTTGGAAGGGTCTAGGAATATATTTAGGTACATTGTCAGGTGCTGCACTAGGGCAATTGATTTTAGCAGGTATTTTGCAA TTCGGAACATTTTCTGTTATGAATTTTTCAATTTATTTTTCAGCTGTTCCTTCATTTATAGCATTCAGTAGTTTTGTAGG AATAATATTATTAAGCATTATAATTGTTATTTGTCTTCTTGTGTGGTTGTGGCCATCAAGAGGGAAATTGATGGGTAAAG ATAAAACAGAAAATAAAAGTGATACATAAATATATATATATATATATTTTTGTTAGAATATGGAATTATTTAATTTTATT AAAAAAAAACAAATTAACAGCAAAGAAAAAAAAAAAATAGGAAAATGGAAATTAAGTTGTTCTAAGTTTGTTGTAAATTT TAATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_289: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000752320317AA5500651159m3gmbPfHB3.1, G. Roman Reddy
12004002320642AA5503901538m3gmbPfHB3.1, G. Roman Reddy
12006962320938AA5506861923m3gmbPfHB3.1, G. Roman Reddy


Date: 4:2:57 on Thu 23 Nov 117.