CPlasFal_29


Sequence

>CPlasFal_29 (2 EST) Length=733 TTTATATATCCATAAATATAAAGGAGAATTAAATAAAATATAATACAATATAATGTAATATAATATTTGTATATAGAAAT AAAAGATATATCTTTACTATAATACTAATATAGCTAATATTTGAAATTTTATATTATTAATATTCATATCATTATTTGGA AATCAATTAGTGGGAATATAAAAATGTTTATTAATAAATTTGTTATTTCATATTAAATTTAAATTTCTTTTCTTATAGTT ATACAACCTTTTAATACTGTCGTCATAATTTATATTATATTATATTTGATATATGTTTTACCTTTTAAATTTGCACTCTT TTTTTTTTTTTTACTTCATTTTTTTCTTTACCTTTCACTCGTTTATTATTACGAAACCATGTTTCATGGTTATTAAATGT ATTAATTAAAAAAAATACACATTATTATTATTTATAATATTTTTATCTTTATCTTTATTTTTACTAGTTTCATTTTTATG CTTTCATTTTATATTATTCTCCATATCTTAAATATCAACTTCATCAAATGAAGAACAATATTATGTTACTACATATAAAA TGTGCTATTTCCTTTTTTTTTTTTTTTTTTTTTTTCCCATACTTATTATTTTCTATTATGTTAAAATTTTGTTTATGATA TTTTGTCAAAGTTTCATATAAATTCATGTAATTATTTTTATTTACAAATACCCCTATGTCTTTATTTGTATATTTAAATA CATATATTATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_29: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005692320811AA5505591722m3gmbPfHB3.1, G. Roman Reddy
12006072320849AA5505971763m3gmbPfHB3.1, G. Roman Reddy


Date: 22:38:5 on Thu 23 Nov 117.