CPlasFal_295


Sequence

>CPlasFal_295 (2 EST) Length=979 TATATAACATACCATTTTATGCTTTGTCTAAGATAAATATTATTATAACATGTTCATACCCTTTACAATTCTATTATATA ACAATATTTACGAAATAAGTATATTATCGGGAAGTCTTTCAATTTTATATTTAAAATTTTTCGCATATAAAATAGGAACT CCCGGTATTTTTCTTAATCTTATTTTAAGATCTCTATCGTTAGTGGCAATAATATAACAACGACTTTCTGTAACTCTATT AACTATACAATCATCAGCATAAGTACCTTTATGATTACAAGTTAATCTTTTAAAACGAGGATCCTTTATTAATTTTAATC CTAGAGAATATCTTTGTCCTAACTTTTCCATTTCTCCTATTACACAATCTGTTACAAAAATATTACATTTGGCTAGTAAA ACCTCTGAACATCCTTTTATTATGTCAATTTTATATTGTATACTGGAATTTATAAAATTGGTATCCAGGATTATATTATA TGGTGGACACAAATTTTCATTATAATTAAAAAATAAGTTACTATCTATTACTTCTATTTGTTTCAACTTCTCACTCTCTT TTTTTTTTTCTTTTTCTCTCTTCTTCTGAATATTATTATGATCATTTTTTATGTTATATTTAAGAAATTCTTCATCCAAT AACATCATAATAATACTCTCTCTTTTTTCCTTATTTAACTTATAACAACAATAAATATATGCATATTTCATTATATTATC GCATTTTTCATCTTGACATTCCTTTCTTGAATAAATGTACAAACGATTTAAATCCTCGTAATTTATATAATTGTTGTTAG ACCTTATGTTTTCTTTTATATTTATTTTATGTCTATAACAATAAGTATCTATCAAATCGTCGTACAACCTTTTTTGAAAT TTTAAATTATACTTTTTAGAAATATCTATACCGTTTAAGAAGAAGTTTAAATAACACCTATGATTTTCATCATCTTCCAT GATATAAATAAATAGATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_295: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002942320536AA5502841413m3gmbPfHB3.1, G. Roman Reddy
12006952320937AA5506851922m3gmbPfHB3.1, G. Roman Reddy


Date: 19:0:58 on Thu 23 Nov 117.