CPlasFal_299


Sequence

>CPlasFal_299 (2 EST) Length=915 ATAAATCTTTTGTATTTTTACTTTTATATATATTATCAAATTGCTTACTGAGTTCTGTCAAAAAGTCCAAATCGTATATT CTTTCCATATAACAAAAATATAGCATAGAAAATATATCTACAAATTTTATCTGATGTTTATTAGAATCATCTTTTGAAAA TTCAATCTTATATTGTATAAATTCAAGTAGTACATTCTTATATTCGTTTATATATATATTTTTTTTATCATCAGTACTTT CCTTAGTGAAAAAATCTATAATAAAATTTGGGATGACATCAGGATTTTTTTTATCATGCTTTTTTAGGATATCATTAAAG AATGGACTCTTTATATTGTCACAATTTTCCTTAGTATGAGCATATTCTTCATTTTTATTATTTTGAATGTTTAAATTTTT AACTTTATCATCTTTATCATTGTTATTCTTTTGCATAGAATTAAAGTTTACTCTTTTTATAAATTCTGGTATATCATTTT TTATTAATATATATCTTTTATATAAACTTGGTCCATGAAAATATCTTGAAAATAATATACGTCTTGTTAACATTTTATTT TTATTCATTATTTATTTATTTTTTGTTTTTTTTTTTTATTTTTTTNTTTGAAGANTAGAAAGCATTTATCTNCTATCTTT TGAAATATGAAGGAATATNCTCATATTATTGGAACGGGAGATTTNTTTAAGAGTGAGGATAGATGTTGGGTTCTTTTGGC TAGTAAATCGCCTCGAAGGNTTGAATTAATGAAGTNAATGGGTATAAAAAATTTATATATTTGTGAATCAGGTTNCGAAG AAAATTTAGATAAGCATATTTTTCCTTGTGCTGAAGATTATGTTAAAGAAAATGCATTAACTAAGGGTTTGAATGTNGTT NGACCGTGTATGGGTTTCCTAATAATTCCCAGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_299: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28716319452T096200203m7gmbPfHB3.1, G. Roman Reddy
12002912320533AA5502811410m3gmbPfHB3.1, G. Roman Reddy


Date: 12:31:26 on Sun 19 Nov 117.