CPlasFal_30


Sequence

>CPlasFal_30 (2 EST) Length=735 TATCCTATTCATATTAAAGTATAGATGTGAATATAGGAAATAATTTTTTATATATGATTTTATTTTAAAAAAAAAAATGC TTTTTAAAATAGATAACCTTTTTATGAGGCTTTAAAATTATCCTACATTAATCTGTAATATGACTATATAATCACACTCA AAATGAATTAATATGTTAAAAGTACAAGCATAAAGATCTATAGATTTTCTTACATCGTTCTGATCACATCTTAGGAATGG ATTATATAAATATTCATGCTCAAGTAATGTAGGAACAGTAGGATAATTTTTGTTTGAATTTACAACATGGTCATAAAAGG ATAATAAATTTTTATTAGTACTATCAACAGTTAAAGCAAAATTTTAAANTTATCGAGTGTATATTCATGACCACAAAATA TGTATATATTTTGTTTATCTAATAATTTTAATTTATTTATAGAATTATATAAATCTTCATTGTCTTGTTCAAAATTTTTT CCTATTCCACTTATAAATAAAAAGTCTCCAGTGAAAAAAATATTTTTCTTTGATTTATTATTATCATTTTCAATTAAATA AGAAACTTGATTTTTACTATGAAAATTAGAAAGGAATATGTTTATTTTAAAATTATTAATTTGGAAATGTGTAAGATTTG AAATATCTTGATTAATATATTTATTATCATATTCTTTTATACCATATACATTTATATTTTTCTCATAATAATATTGATTT CCATTATTATGATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_30: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44187462934T181480723c3czapPFDd2.1, Debopam Chakrabarti
12001412320383AA5501311233m3gmbPfHB3.1, G. Roman Reddy


Date: 17:20:28 on Fri 24 Nov 117.