CPlasFal_315


Sequence

>CPlasFal_315 (3 EST) Length=833 TCGTCATGTTTTTATAAGGACTGAGTTATCGTTCATAAAGAATAATGTTCCCTTGTATTCGTGATATGTTTTTTATATAT AAGAGGGAATTGTATAATATATGTTTAGATGATTTAAAAGGCGAAGAAGATGAAACCCATATATATGTTCAAAAGAAGGT AAAAGATTCTTGGATAACTTTAAATGATTTGTTTAAAGAAACTGATTTAACAGGCCGTCCTCATATTTTTGCATATGTAG ATGTGGAAGAAATAATTATATTACTTTGTGAGGATGAAGAATTTTCAAATAGAAAGAAGGATATGACTTGTCATCGTTTT TATAGTAATGATGGAAAAGAATATAATAACAGTGAGATAACTATAAGTGATTATATATTAAAAGATAAGCTTTTATCATC TTATGTTTCTTTGCCTTTAAAAATTGAAAATCGTGAGTACTTTCTAATATGTGGTGTAAGTCCTTATAAATTTAAGGATG ACAATAAGAAGGATGACATTTTATGTATGGCAAGTCACGACAAAGGCGAGACATGGGNGTANANAACCAAAATAGTCATA AAATATGACAATTACAAATTAGGTGTGCAATATTTTTTTCTAAGACCCTACATTTCTAAGAACGATTTGTCATTTCATTT TTATGTAGGTGATAATATAAATAATGTAAAGAATGTTAATTTTATTGAGTGTACCCATGAAAAGGATTTAGAATTTGTCT GTAGTAATAGGGATTTTTTAAAAGATAATAAAGTACTTCAAGATGTTTCTACATTAAATGATGAATATTATCGTTAGTTA TGGAAATGATAATAATTTCCCTGAGTGTTATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_315: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44156462903T181170665c3czapPFDd2.1, Debopam Chakrabarti
5049961675180N981302225C3czapPFDd2.1, Debopam Chakrabarti
12001212320363AA5501111210m3gmbPfHB3.1, G. Roman Reddy


Date: 16:29:29 on Mon 20 Nov 117.