CPlasFal_317


Sequence

>CPlasFal_317 (7 EST) Length=1353 TTTATTCGGTTATTTTTTATACTTTCAGTAGTATCTTTTGTTTCTCCGTATACTTTCCATTTAATTATTAATGTATTCTC CTTAATATATACTACCAACTTGAAGTTTTTTCCAGTTTCACATATATTTTGTAAATTTCTTGGCGGTTTAACAGTAGGGG AATCAGGTCCATTAGCAGGAAGACTTCCTGAACTTGAACTAGAACTTGAACTAGAACTTGAACTTGAACTTGAACTTGAA CTAGAACTTGAACTTGAACTTGAACTAGAACTTGAACTTGAACTTGAGCTTGAATCTGAAATTGGTTCTGTATCTCCTCT AACTGTTCCCGTACTTGAACCTTGTTCACCAGTTGTACCATTTGATGGTAGTTTTACATATTTTTTTTTTTCTAATGAAC CACTGTTTGATTCAAATGATATTGCATTATTTGTTTCTTTCAATGTTGTTCTTAATTCGATATTAGTATCTTCTGTATCA ACATCAATATATATATGAGGAACTAAGAACATTATGAAATTTCCGTTACATGGACCAGTAACTTTTAAACCCATATAATC TTTTAATAAAGCTGATTTTACTTGAATTGTATCCTGTTTTTCTGAAGAAGTTGAAGTTTGTGATACTGATACAGTACTTA CAGAATGTCCGGAACTTACAGGATTGCTTGGTTCGGAACTTCCGGGTTGACTTGCTCCCGTACTACCTTGTGGACTTCCT CCTGTACTACCTGCTTGATCTCCTACTGTATTACCTGCTTGACCTCCTCCTGTATTACCTGCTTGACCTCCTCCTGTATT ACCTGTTTGACTTTCTCCTGTACATTTTATAACATTTTTGTTAAATATAACACACAATATGAAAAACAAGGAAATATATG ACTTCATTTTGATATATGAATATTAAGTTATATAATATTTTAAGAACTTTAATTTTTTTGAATATGTTTGATTTATTTAA TTTTTCTTTATGTTATAATATATGTATTTATATATATATATATAAATATTTATTTTTTTATTTTTTTTTTTTAACTTTTG AAGAATAAGTTTAGATGGGACGTGGGGAGGACAATTAGAACTTCAAGCCGTAGGAGAAATTTACAAAGTAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAATATCCCTATATATATTAAATCATTTCCAAAATTTTTTTATTTTTCTATTAATTCNGGT TAATATTTTAATATATCAAGAGAATGGTTGTNTACTTGAAATTAAAAATCACAGCGATGATAATAAATGTATACAATTAC ATTATGCTTCTAGTGTAATATTATAAAAGAAAAAGAATAATATGAAACTATATAATATATATTATTATAATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_317: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44280463027T182410898c3czapPFDd2.1, Debopam Chakrabarti
44282463029T182430900c3czapPFDd2.1, Debopam Chakrabarti
5045681674752N977341165C3czapPFDd2.1, Debopam Chakrabarti
5048301675014N979801746C3czapPFDd2.1, Debopam Chakrabarti
5049021675086N980522116C3czapPFDd2.1, Debopam Chakrabarti
12001632320405AA5501531266m3gmbPfHB3.1, G. Roman Reddy
12002802320522AA5502701397m3gmbPfHB3.1, G. Roman Reddy


Date: 23:0:58 on Fri 24 Nov 117.