CPlasFal_32


Sequence

>CPlasFal_32 (2 EST) Length=781 GAGAAAATTATTTCAATTGAAGATATATTTTATTATATTGGTGACATTATGAAAGAAATGATGGAAGGACAAAATATACG AGAAGAGAAAGTAGCTGAATTATTAAAAGATAGATTAGATTTATATATAGATAATGAGGATGAATACGAGATATTAAAAG AAAATGATATTGGCATGTTATTAAAATCTTCATTTTCGAATTTTATATTAGAATCTATAGGATGGACATATGAGAATATT TCTAATATTGTTTTAGAAGAAAAAGAATTTTCTGATATAAATAAAAAAGTTATATATATAAAAGAAGTCAATGAGAGAAT GATTAGAAATTCAATTAGTTTGAGACAATGTAAAAGGCCGCTTTATACCTATAATAACCAAAGTATTACCCTTTTAAAGA ACAAAATAACCCTTTTATAAAGCAGGCACAATATGTATCCTCATCTAATTATGTATTGAATGATATAAAAAATAATATAG ACTATAGTATAGATAATATACATAGAGCCATAGATAATTCATACAATGAACATATATTAAATTTATTAGAGGAAGAAAAA AATAAAATACTAGAAGAAATATTAAGGAATATTCTAAAAATTATTTTGTGTGATGTTGAAACAAAAGTAAGAAGATCAGC ACAAAAAGTATTACAGAAATAAAGAAGCAGATACAAATTTGATGCTTAAAAGAGATAAAGGATTACGAATCATTGGGTAA AATGATACGACAAAAGATCAATTAAAGATATATTATATGTACACACACATATAAGGGATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_32: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28849319585T097530347m7gmbPfHB3.1, G. Roman Reddy
12006012320843AA5505911756m3gmbPfHB3.1, G. Roman Reddy


Date: 10:33:52 on Tue 21 Nov 117.