CPlasFal_325


Sequence

>CPlasFal_325 (7 EST) Length=830 TTTTAATTTAATTTAATGTATTCTATTTTATATTTTTTTGAACCATTATATATATTAAATGTACCAACTTTTTTTTTTTT TTTTTTTTTTAACATTTCAGAGATTTACATGTTTATGAAGAACAAGCTCTTATCACCAGTAAAATGTTAGACATTATTCA GATACCTGAAGGAAGAGCTTTTTATGGTTTTCAAATGTGTATGGAGAATATACATGATGAAGTATATGCTTGTATATTCG AAACATATATTCCTGATTCAAAACAGAAAAGGGTAATAATAAATAAAGTGATTGAGTTAGACAGTGTTTTAAAAAAACAG AAATGGCTAACTGAAATATTCGAATCGAATATCCCATACTATAATAAACTTGTTCTTCTTTATATTTCTAAAGTTCTTTT TAATGGTACATTAAATATATTAATTGGTTATTGCAAAGAAAATTCTATACTCCCTTGCTTATGTAATGTTCATGAAAAAA TTCATAGAGATGAATATCTTCATGGAGATTTTTCCGTTATGTGTTGTAACCATTTAGTTAATAAATTAAAATATGAACAT GTCTTAGATTATTTTAAAATGGCTGTTGATTTAGAATATCAATTTTCACTGGAAATGTTAGAGCTCAATGTTCTTAAAAT AAAGAAGGAACAAGTAAGAGCATTCTTAGAATATTTAACAGATACCATGTTGACTAATCTAAAGTATCCAAAACACTATA ATTCCAAGTACCCTTTTAGTTGGCCCGAATTTACAAAAGTAATAAAAGAAAAAAAAAAAAAAAACATAAATGAATAAATG AAAATAAATAAATAAATAAATATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_325: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28753319489T096570229m3gmbPfHB3.1, G. Roman Reddy
28964319700T098680436m3gmbPfHB3.1, G. Roman Reddy
28965319701T098690436m7gmbPfHB3.1, G. Roman Reddy
5042021400063N973540229M7gmbPfHB3.1, G. Roman Reddy
12000092320251AA5499991078m3gmbPfHB3.1, G. Roman Reddy
12000172320259AA5500071086m3gmbPfHB3.1, G. Roman Reddy
12003982320640AA5503881536m3gmbPfHB3.1, G. Roman Reddy


Date: 21:36:22 on Fri 24 Nov 117.