CPlasFal_336


Sequence

>CPlasFal_336 (2 EST) Length=1008 ATGTATTCGAGCTATGGATTCAGATAAAAATCATATACCTTTCAGAGATTCAGAATTAAGTAAAGTTTTAAGAGATATAT TTGTAGGGAAATCTAAAAGTATTATGATAGCTAATATTTCTCCTACAATTAGTTGTTGTGAGCAAACATTGAATACATTA AGATATTCTTCAAGAGTTAAGAACTTTAAAAATAAATCTACATGTATAAATGAAGAAGATGATACAAATACCGAAAGAAT TAGTATATTAGATTCAAAGGGAAGTGAAATGAATGCATCTAGTATAGAAAATGTAGTTATCAAATCAAATCATCTTCTTT CAAATAATAATAATAATAAAATCAATCGTGGGAAAATTAATGATAAGATAGAAAGAAATAATATCTTAAAAAATAAATCT TTTGATAAACCTAGGGAAGGATTCACATCAACCTTTGGAAAATACAGTTCACTTAATGATATAGACAAAATAAAGAAAAA TAAGAAAAAGGGTTTAATTAATTATAAAAGTACATTATATAATGACAACACCATAAATAAGAAAGCACAACAATAATAAT AATAATAATGAGAATAATGAAAAAAAATGTGCAAATATGATATATCATGAGAATATGATCCATAAAAATATTCATAAAGA TAGTATTCAACATTTGGATAATAAAAAAAATGCTTTAAGACAAAAACAAAATGATTTTAAAATTATCAAAGGGAAAAATA ATCAAAGGGAACGTTATCAAAATTGTAATTTATTAAAACATTTAAATAATAAAAAGAATGAACTACAAAATATTTATATT TTTAAGAAGAAGAAGAAGAAGAAGAAAAAAAAAAAAAAAGGTTATTTAAACGTTCAAAGGAAAGCAATATNCAAAAGAAA AAAAGAAAAAAATTTATTTTCTNCTTNGATATTATTAATTAAAACAAAGAGAAGATATCATAGGAATTTTTTTGTAACGA ATAAAGATAATGGTAATATAAAATATTGTAAGGAAGTNGAAAAAGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_336: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998962320138AA5498860959m3gmbPfHB3.1, G. Roman Reddy
12006152320857AA5506051774m3gmbPfHB3.1, G. Roman Reddy


Date: 20:47:35 on Sun 19 Nov 117.